Guide RNA
Guide RNAs are the RNAs that guide the insertion or deletion of uridine residues into mitochondrial mRNAs in kinetoplastid protists in a process known as RNA editing.
The terms "guide RNA" and "gRNA" are also used in prokaryotic DNA editing involving CRISPR and Cas9. For this prokaryotic DNA-editing system, the gRNA confers target sequence specificity to the CRISPR-Cas9 system. These gRNAs are non coding short RNA sequences which bind to the complementary target DNA sequences. Guide RNA first binds to the Cas9 enzyme and the gRNA sequence guides the complex via pairing to a specific location on the DNA, where Cas9 performs its endonuclease activity by cutting the target DNA strand.
In addition to expression of the Cas9 nuclease, the CRISPR-Cas9 system requires a specific RNA molecule to recruit and direct the nuclease activity to the region of interest. These guide RNAs take one of two forms:
- A synthetic trans-activating CRISPR RNA plus a synthetic CRISPR RNA designed to cleave the gene target site of interest
- A synthetic or expressed single guide RNA that consists of both the crRNA and tracrRNA as a single construct
History
The RNA-editing Guide RNA was discovered in 1990 by B. Blum, N. Bakalara, and L. Simpson because of their role in RNA editing in the mitochondrion of Leishmania tarentolae. These gRNA molecules are encoded in maxicircle DNA in mitochondria having sequences that are complementary to mature mRNAs within the edited regions. They participate in multiple activities to cleave, insert, or delete bases after the formation of partial hybrid between gRNA and pre-edited mRNAGuide RNA in Protists
protists and other kinetoplastids have a novel post-transcriptional mitochondrial RNA modification process known as "RNA editing". They have large segment of highly organized DNA segments present in mitochondria. This mitochondrial DNA is circular and exists in one of two forms, maxicircles or minicircles. There are 20-50 maxicircles per cells having both coding and non coding regions. The coding region is highly conserved and non coding region varies depending on the species. Minicircles are small but more numerous than maxicircles. Minicircles constitute 95% of the mass of kinetoplastid DNA. Maxicircles can encode "cryptogenes" and some gRNAs; minicircles can encode the majority of gRNAs. As many as 1000 gRNAs can be encoded by 250 or more minicircles. Some gRNA genes show identical insertion and deletion sites even if they have different sequences, whereas other gRNA sequences are not complementary to pre-edited mRNA. Maxicircles and minicircles molecules are catenated into a giant network of DNA that is situated at the base of the flagellum in the inner compartment of the single mitochondrion.A majority of the maxicircle transcripts can not be translated into proteins due to multiple frameshifts in the sequences. These frameshifts are corrected after transcription by the insertion and deletion of uridine residues at precise sites which create an open reading frame that is translated into a mitochondrial protein homologous to mitochondrial proteins from other cells. The insertions and deletions are mediated by short guide RNA which encode the editing information in the form of complementary sequences.
gRNA-mRNA Complex
The guide RNA are mainly transcribed from the intergenic region of DNA maxicircle and these are complementary to mature mRNA. It is important for gRNA to interact initially with pre-edited mRNA and then its 5' region base pair with complementary mRNA. The 3' end of gRNA contains oligo 'U' tail which is a non encoded region but interacts and forms a stable complex with A and G rich region of mRNA. This initial hybrid helps in the recognition of specific mRNA site to be edited.Function
The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein complexes that direct the cleavage of first mismatched base adjacent to gRNA-mRNA anchor. Uridyly transferase inserts 'U' at 3' terminal and RNA ligase is responsible for joining of two cut ends. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites, the editing of which produces a complete gRNA/mRNA duplex. This process of modification is termed as original enzyme cascade model.In the case of "pan-edited" mRNAs, the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.
It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondrion of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids, and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.
In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
The 3' end is used to anchor the gRNA by basepairing. The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'
The mRNA is now "repaired" by adding U's at each editing site in succession, giving the following sequence:
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'
This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA
Guide RNA in Prokaryotes
CRISPR In Prokaryotes
Most of the prokaryotes like bacteria and archea makes the use of their adaptive immune system using CRISPR and cas enzyme to detect and remove the foreign genetic material. When prokaryotes are infected by bacteriophages, then the phage DNA give rise to short cluster repeats which are used to detect and cleave the DNA fragments from similar type of phages. This defense mechanism of prokaryotes is used as editing technique which can used in gene therapy process as well. The CRISPR Cas editing method makes the use gRNA for identification and cleavage of DNA strands.Structure
Guide RNA targets the complementary sequences by simple Watson and crick base pairing. In type II CRISPR/cas system, single guide RNA directs the target specific regions. Single guide RNA are artificially programmed combination of two RNA molecules, one component is responsible for Cas9 endonuclease activity and other binds to the target specific DNA region. Therefore, the trans activating RNA and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA. TracrRNA are base pairs having a stemloop structure in itself and attaches to the endonuclease enzyme. Transcription of CRISPR locus gives CRISPR RNA which have spacer flanked region due to repeat sequences, consisting of 18-20 base pair. crRNA identifies the specific complementary target region which is cleaved by Cas9 after its binding with crRNA and tcRNA, which all together known as effector complex. With the modifications in the crRNA sequences of the guide RNA, the binding location can be changed and hence defining it as a user defined program.Applications
Designing gRNAs
The targeting specificity of CRISPR-Cas9 is determined by the 20-nt sequence at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif which is a short DNA sequence usually 2-6 base pairs in length that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site. After base pairing of the gRNA to the target, Cas9 mediates a double strand break about 3-nt upstream of PAM.The GC content of the guide sequence should be 40-80%. High GC content stabilizes the RNA-DNA duplex while destabilizing off-target hybridization. The length of the guide sequence should be between 17-24bp noting a shorter sequence minimizes off-target effects. Guide sequences less than 17bp have a chance of targeting multiple loci.